gbsR [2019-05-22 12:25:19]

transcription repressor of the gbsA-gbsB operon

Locus: BSU31070

Isoelectric point: 4.62

Molecular weight: 20.92 kDa

Protein length: 180 aa

Gene length: 543 bp

Function: regulation of osmoprotection

Product: transcription repressor

Essential: no

Synonyms: yuaC

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Miscellaneous metabolic pathways → Biosynthesis of glycine betaine
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Lifestyles → Coping with stress → Coping with hyper-osmotic stress

Gene

Coordinates: 3,186,763 3,187,305

The protein

Catalyzed reaction/ biological activity

• sensing of choline and arsenocholine PubMed
• control of the gbsA-gbsB and opuBA-opuBB-opuBC-opuBD operons PubMed

Effectors of protein activity

• binds the inducer choline with an apparent K(D) of approximately 165 M PubMed
• binds the inducer arsenocholine with an apparent K(D) of approximately 2.1 mM PubMed

Expression and Regulation

Operons

• Genes: gbsR
  Description: PubMed

  Regulation

  • upregulated in response to salt stress PubMed

Biological materials

Mutant

• MGNA-A219 (yuaC::erm), available at the NBRP B. subtilis, Japan
• BKE31070 (gbsR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACTGACCCTCTTTTCCT, downstream forward: _UP4_TAAAGCAGAAAACGCCTGGG
• BKK31070 (gbsR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACTGACCCTCTTTTCCT, downstream forward: _UP4_TAAAGCAGAAAACGCCTGGG

Labs working on this gene/protein

• Erhard Bremer, University of Marburg, Germany homepage

References

Loading